MatTek Logo Home English | German | Japanese | About | Contact | Sitemap | Search | Shopping CartCart

Technical Reference #282

Glass Bottom Culture Dishes

This study used MatTek product(s):

P35G-0-14-C

282.

The Ras-like GTPase Gem is involved in cell shape remodelling and interacts with the novel kinesin-like protein KIF9 Eugenia Piddini; Johannes A. Schmid; Rainer de Martin; and Carlos G. Dotti, EMBL, The EMBO Journal, 20(282), (2001)
Link To Paper

Abstract:
Gem belongs to the Rad/Gem/Kir (RGK) subfamily of Ras-related GTPases which also comprises Rem Rem2 and Ges. The RGK family members Ges and Rem have been shown to produce endothelial cell sprouting and reorganization of the actin cytoskeleton upon overe

Keywords:
actin/cell morphology/GTPases/kinesin/microtubules

Materials & Methods:
Cell lines and primary cultures COS cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal calf serum (Gibco-BRL) 2 mM glutamine and penicillin (100 U/ml)/streptomycin (100 µg/ml) and maintained at 37°C and 5% CO2. HUVEC were grown as described elsewhere (Stehlik et al. 1998). HEK-293 cells were grown as described in Schmid et al. (2000). Primary cultures of hippocampal neurons and of glial cells were prepared according to the protocols of Goslin and Banker (1991). Drug treatment and transient transfections were performed as described in the Supplementary data available at The EMBO Journal Online. Immunocytochemistry Cells were grown for 18–24 h on glass coverslips rinsed with phosphate-buffered saline (PBS) and fixed either in ice-cold methanol for 5 min or in 4% paraformaldehyde for 10 min. Immunofluorescence labelling was performed as described in Santama et al. (1998). The following primary antibodies were used: mouse anti-Gem P2D10 (1:100; Maguire et al. 1994; a gift from K.Kelly); rabbit anti-tubulin (1:100 a gift from E.Karsenti); rabbit anti-actin (1:20 Sigma); M1 mouse anti-Flag (1:500 Sigma). For the anti-Gem antibody a sandwich of secondary antibodies was required [fluoroescein isothiocyante (FITC)-conjugated sheep anti-mouse followed by FITC-conjugated donkey anti-sheep]. Image acquisition live cell imaging and quantification of the Gem phenotype are described in the Supplementary data. Two-hybrid screening The yeast two-hybrid screening was performed with components of the Matchmaker Two-Hybrid System 2 (Clontech Palo Alto CA). The core region of Gem (amino acids 72–265) was cloned by PCR (forward primer: 5′-AAAACCATGGGGAACACCTACTACCG-3′; reverse primer: 5′-TTTTGAATTCTATTTCCTGGGCATGCTCTC-3′) in-frame into the Gal4BD-containing bait vector (pAS2-1; Clontech) using the NcoI and EcoRI sites. The resulting construct was verified by sequencing. Further details of the two-hybrid screen procedure are given in the Supplementary data. The two-hybrid screen was performed using a library from phyto hemagglutinin (PHA)-stimulated leukocytes (Clontech; HL4021AB). About 5.4 × 106 transformants were screened yielding 227 positive colonies; 14 colonies with high lacZ expression were analysed further. Yeast DNA was prepared by the method of Liang and Richardson (1992) followed by electro-transformation into HB101 bacteria. Sequence analysis of the strongest lacZ-positive interaction partner of Gem revealed the partial cDNA sequence of a yet unknown protein. Cloning of full-length KIF9 cDNA To obtain the full-length cDNA sequence of the newly identified Gem interacting protein we performed 5′ and 3′ rapid amplification of cDNA ends (RACE) reactions using the Mouse Brain Marathon-Ready cDNA kit (Clontech Laboratories Inc. Palo Alto CA). Since we had used a human library for the two-hybrid screen and our RACE library was from mouse we first obtained the murine equivalent of the partial human clone obtained by two-hybrid. Primers selected from the ORF of the human partial cDNA sequence (forward: GCACCTTTGTGACCTATGACCCCATGG; reverse: TTTTCTGTGTGACTGTTGGAGGCCCA) PCR amplified a murine cDNA fragment which upon sequencing was shown to be 82.7% identical to its human counterpart. The RACE reactions were performed according to the manufacturer’s instructions. The reaction program used was Program 1 of the User Manual. Advantage KlenTaq Polymerase Mix (Clontech Laboratories Inc. Palo Alto CA). The 3′ end RACE reaction produced different identical clones whose sequence overlapped at the 5′ end with our partial cDNA clone and contained a stop codon a 3′ UTR and a poly-A tail. From the 5′ end RACE reaction it was possible to isolate some clones whose sequence overlapped at the 3′ end with our partial cDNA clone and contained the beginning of the ORF at the 5′ end (a start codon that was preceded by an in-frame stop codon). The full-length cDNA clone of KIF9 was then obtained performing a PCR with the following pair of primers: CCTCAAGTTGCTGCAGTTCTAGCGGTC and GCAAGGGTGTCCTTTGGAGGATGCTCATCC. The reaction programme and conditions were the same as used for RACE except for the template cDNA which was from isolated mouse embryonic hippocampi. The PCR product was cloned in pCR2.1; upon sequencing two clones were confirmed to contain the whole KIF9 ORF. Gem and KIF9 mammalian expression vectors Relevant features of the Gem and KIF9 mammalian expression vectors used in this study can be found in the Supplementary data. Isolation of mRNA Poly(A)+ RNA was affinity purified with a QuickPrep Micro mRNA purification kit (Pharmacia Biotech Sweden) from hippocampal neurons in culture (1 and 10 days old) glia primary cultures and isolated hippocampi. Mouse embryonic (E17) and adult kidney mRNAs were a kind gift of Marino Zerial. RT–PCR cDNA synthesis was performed using ~10 ng of mRNA and the MMLV reverse transcriptase (Advantage RT-for-PCR kit Clontech Laboratories Inc. Palo Alto CA). Specific primer pairs were designed to monitor KIF9 (forward: ACCATGACAGGGGCAACGGAGAATTACAAGC; reverse: GGAGGCAATGATC CTGTTGGTCTCGCC) and Gem/KIR (forward: ATGACTCTGAATAATGTCACCATGCCGCCAA; reverse: ATAAGCACTACTCGGTAGTAGGTGTTTCCA) expression by PCR amplification. The PCR reactions contained: ~1 ng cDNA 10 nmol of each dNTP 1 unit of AmpliTaq DNA polymerase (Perkin-Elmer) and 20 pmol of each primer in 1× Perkin-Elmer PCR buffer (containing 1.5 mM MgCl2) in a total volume of 50 µl. The PCR amplification consisted of 33 cycles of: (i) 10 s at 94°C (ii) 10 s at 60°C and (iii) 35 s at 72°C. To obtain a semiquantitative analysis primers specific for the glyceraldehyde-phosphate dehydrogenase (GAPDH) housekeeping gene (20 pmol each) were added to the PCRs; the GAPDH cDNA was used as internal standard to normalize the concentration of the different cDNA samples. As the GAPDH mRNA was more abundant than the KIF9 or Gem mRNA KIF and Gem cDNAs were allowed to undergo five initial cycles of amplification before the GAPDH primers were added. Under these PCR conditions none of the cDNAs was amplified to saturation. Co-immunoprecipitation HEK-293 transiently transfected with Flag-Gem and/or KIF9HA or the C-terminal part of KIF9 [KIF9(379–790)-HA] were lysed for 15 min at 4°C with lysis buffer (0.5% NP-40 50 mM Tris–HCl pH 7.5 1 mM EDTA 150 mM NaCl and including protease inhibitors: 10 µg/ml aprotinin 20 µg/ml phosphoramidon 40 µg/ml pefabloc 1 µg/ml leupeptin 1 µg/ml pepstatin). The extracts were centrifuged for 15 min at 14 000 g at 4°C. The supernatants were diluted with an equal volume of ice-cold PBS before adding 15 µl of an anti-Flag affinity matrix (Sigma) followed by rotating incubation at 4°C for 2 h. The beads were washed four times with ice-cold PBS and the bound material was eluted in SDS–PAGE buffer. A list of the primary antibodies used in this and the following biochemical experiments can be found in the Supplementary data. Subcellular fractionation PNS (post-nuclear supernatant) preparation. COS cells transiently transfected with pMT2TGem and pcKIF9HA (one confluent 15 cm dish) were washed twice with PBS and scraped in MEPS buffer (5 mM MgSO4 5 mM EGTA 35 mM K+PIPES pH 7.1 1 mM dithiothreitol 0.2 M sucrose) plus 1 mM 4-(amidino-phenyl)-methane sulfonyl fluoride (APMSF) and a mix of protease inhibitors (20 µg/ml aprotinin chymostatin pepstatin and leupeptin). The sample was homogenized and centrifuged at 800 g for 10 min. The resulting PNS was subjected to differential centrifugation steps (10–20–100 000 g for 30 min each) pellets were recovered from the three fractions the supernatant from the last centrifugation step was precipitated with trichloroacetic acid (TCA) and regarded as the cytosolic fraction. Comparable protein amounts were subjected to SDS–PAGE and western blotting. Sucrose density gradient sedimentation PNS from COS cells transiently transfected with pMT2TGem and pcKIF9HA (seven confluent 15 cm dishes) was obtained as described above loaded on top of a 20–60% continuous sucrose gradient and centrifuged at 35 000 rpm for 16 h at 4°C in a SW40 rotor. The gradient was divided into 16 fractions collected from the top of the tube. After the sucrose density of each fraction had been measured they were precipitated with TCA. Equal sample volumes were subjected to SDS–PAGE and western blotting. Microtubule cosedimentation assay PNS from COS cells transiently transfected with pMT2TGem and pcKIF9HA (two confluent 15 cm dishes) was prepared as described above with the exception that the buffer used was BRB80 (80 mM K+PIPES pH 6.8 1 mM MgCl2 1 mM EGTA). The sample was supplemented with 1 µg/ml cytochalasin D and incubated for 30 min at 4°C. The extract was then clarified by centrifugation at 165 000 g for 20 min. The supernatant was split in two samples: one (N) was supplemented with 40 µM nocodazole and kept on ice; the other (T) was supplemented with 2 mM GTP 2 mM MgCl2 and 20 µM taxol and incubated for 30 min at 33°C. AMP-PNP (1.5 mM) was added to the T sample which was subsequently incubated for 20 min at room temperature. Both samples were spun through a 15% sucrose cushion at 165 000 g for 20 min at 25°C. The resulting pellets were resuspended in SDS–PAGE loading buffer the supernatants were precipitated with methanol/chloroform and resuspended in SDS–PAGE loading buffer. Pellets were entirely loaded on the gel whereas only 1/10 of the supernatant was loaded.

Microscopic Technique
Video Microscopy, Time lapse

Cell Type(s)
HEK-293