Technical Reference #1646

1646.

Wnt Signals Organize Aynaptic Prepattern and Axon Guidance Through the Zebrafish Unplugged/MuSK Receptor Lili Jing; Julie Lefebvre; Laura Gordon; Michael Granato, University of Pennsylvania, Neuron, 61(1646), (2009)
Link To Paper

Abstract:
Early during neuromuscular development acetylcholine receptors (AChRs) accumulate at the centerof muscle fibers precisely where motor growthcones navigate and synapses eventually form.Here we show that Wnt11r binds to the zebrafishunplugged/MuS

Materials & Methods:
Whole-Mount Immunocytochemistry wnt11r-FLAG In Vivo Staining Embryos were fixed and stained as described in Zeller et al. (2002). For labeling of AChRs embryos were permeabilized in 1 mg/ml collegenase (Sigma) in phosphate buffer for 6–8 min rinsed in 1xPBS and incubated with Alexa Fluor-conjugated a-bungarotoxin (Molecular Probes Eugene OR) as described by Lefebvre et al. (2004). Antibodies and dilutions were used as follows: znp-1 (1:200 DSHB) SV2 (1:50 DSHB) myc (9E10 1:1000 Covance) Prox1 (1:200) F59 (1:20 DSHB) and anti-chondroitin sulfate (CS56 1:200 Sigma). Embryos were imaged with LSM510 (Zeiss) and LCS (Leica) confocal microscopes. Wnt11r-FLAG was affinity purified from transfected HEK cells and injected into live embryos as previously reported for aBTX (Lefebvre et al. 2004) and detailed in the Supplemental Data section. Quantification of AChR Clusters Confocal images were projected into a single plane and converted to a 16 bit image using Metamorph. A region of interest was drawn around the border of each somitic segment. AChR clusters were counted using the ‘‘count nuclei’’ function with the minimum/maximum length set to 5/100 pixels respectively and a minimum average intensity of 60 above background. The results were exported to Microsoft Excel for statistical analysis. Morpholino and mRNA Injections Three to four nanograms of wnt11r translation-blocking MO (wnt11r TL-MO) (Matsui et al. 2005) were injected into one-cell embryos. A splice-blocking MO (wnt11r SP-MO 50TTTTTCTCAGTAACTCACCTCGTTC30 ) was designed against the splice donor site of exon 3. Six to seven nanograms of wnt11r SP-MO were injected into the embryos at one-cell stage. For RT-PCR analysis cDNA templates were synthesized from five 24 hpf embryos. PCR primers were 50-TCCTCACATTCCTGCTCCTGTC-30 (forward) and 50-TCTTCATCTT CATTGGGGCATC-30 (reverse). mRNA was in vitro transcribed from linearized constructs using SP6 mMessage mMachine Kit (Ambion) and injected into embryos at the one- to two-cell stage. In Vitro GST Pull-Down Assay Wnt11r-FLAG-conditioned medium from transfected 293T cells was incubated with GST proteins and GST-UnpSV1ECD fusion proteins expressed in E. coli and absorbed to glutathione sepharose 4B and after washing eluted proteins were detected with anti-FLAG antibody (1:1000 Sigma) and anti-GST antibody (1:5000 Sigma) on western blots as detailed in the Supplemental Data section. Transient Transfection Coimmunoprecipitation and Western Blotting Transient transfection and immunoprecipitation were carried out as previously described (Lu et al. 2004) with some modifications as detailed in the Supplemental Data section. Transgenes Transgenic lines were generated by microinjection of DNA as previously described (Thermes et al. 2002). The lines generated in this studies are Tg(hsp70l:unpSV1-myc)p1 Tg(hsp70l:unpFL-myc)p1 Tg(smyhc1:unpSV1- myc)p1 and Tg(smyhc1:unpFL-myc)p1 in accordance with ZFIN nomenclature. Heat-Shock Condition The embryos from the cross of unpluggedtbr307/tbr307; hsp70l:SV1(FL)-myc/+ to unpluggedtbr307/tbr307 were kept at 28 C to the desired stage before the heat shock. Each pair of embryos was then placed in 100 ml E3 medium in a single well of a 96-well PCR plate. Embryos were heat shocked at 38 C for 35 min at 2.5 hr intervals until they reached the appropriate stage. Transgenic embryos were identified from the control siblings by genotyping using the following primers: 50TGACCAGATGCTCAAATCTGGTCTTTC30 (forward) and 50ATTAAGCTAGCGGTGAGGTCGCCCTA30(reverse). Live Imaging Sixteen to twenty somite embryos were mounted in MatTek glass-bottom culture dishes using 1.2% NuSieve GTG agarose prepared in Ringers plus Tricane and image stacks taken every 2 min using a Perkin Elmar UltraView spinning disk confocal equipped with a 633 lens. Growth cones were analyzed based on their morphologies during pathfinding. Plasmid Construction Standard molecular biology methods were used to generate unplugged FL SV1 wnt11r Dsh plasmids for protein expression yeast two-hybrid and in situ hybridization as outlined in the Supplemental Data section. In Situ Hybridization Fluorescent in situ hybridizations were performed according to Downes et al. (2002) and Schneider and Granato (2006). Probes complementary to 50UTR sequence of UnpSV1 (nt 1-340) or UnpFL unique coding sequence (nt 664– 1012) were used. For wnt11r probes complementary to wnt11r full-length sequences were used.

Microscopic Technique
Confocal Microscopy

Cell Type(s)
HEK-293