Technical Reference #1644

1644.

EphA4 and EfnB2a Maintain Rhombomere Coherence by Independently Regulating Intercalation of Progenitor cells in the Zebrafish Neural Keel Hilary Kemp; Julie Cooke; Cecilia Moens, Howard Hughes Medical Center, Developmental Biology, 327(1644), (2009)
Link To Paper

Abstract:
During vertebrate development the hindbrain is transiently segmented into 7 distinct rhombomeres (r).Hindbrain segmentation takes place within the context of the complex morphogenesis required forneurulation which in zebrafish involves a characteris

Keywords:
Eph; Ephrin; Efn; Hindbrain; boundary; zebrafish; rhombomere; neuroepithelium; cell affinity; cell sorting

Materials & Methods:
Dye morpholino and nucleic acid injections 1-cell stage zebrafish embryos were injected with 1 nl of fixable rhodamine dyemorpholino (MO) or nucleic acid. MO preparationwas as described previously (Cooke et al. 2005). Plasmid DNA or capped mRNA synthesized with mMESSAGE mMACHINE (Ambion) was resuspended in nuclease-free water (Ambion). Morpholinos were as follows: EphA4TB 5 μg/μl (Cooke et al. 2005); EfnB2aTB MO-2 AATATCTCCACAAAGAGTCGCCCAT 3 μg/μl (Koshida et al. 2005). Identical phenotypes to those reported here were also obtained with EfnB2aTB MO-1 10 μg/μl (Cooke et al. 2005). mRNAs were as follows: WT EphA4 from pCS-EphA4 (Cooke et al. 2005) at 300–600 ng/μl; EfnB2a WT and mutant alleles from pCS-EfnB2a and pCS-EfnB2a-ΔCeGFP 1-200 ng/μl; GFP from pCS-eGFP at 100 ng/μl; membrane RFP (mRFP) at 100 ng/μl from pCS-memb-mRFP1 (Megason and Fraser 2003); histone-GFP at 25 ng/μl frompCS-H2B-GFP (Kanda et al. 1998); transposase at 25 ng/μl from pCS2FA-TP (Kwan et al. 2007). The bidirectional heat shock vector pHS-GFP-Tol2was generously provided by D. Kimelman. Full-length EfnB2a and EfnB2a-ΔC were co-expressed with GFP by cloning into the non-GFP cassette of pHS-GFP-Tol2 and injected at 12 ng/μl. EphA4 and EfnB2a expression constructswereMOresistant alleles in which silent base pair changes were introduced. RNA in situ hybridization and immunostaining RNAs in situswere carried out as described (Prince et al.1998) using a krox20/egr2b riboprobe (Oxtoby and Jowett 1993). Plastic sections of RNAs in situwere made as described (Westerfield1993).Whole mount immunostaining was performed as described (Cooke et al. 2005) except some embryos that were fixed in 4% paraformaldehyde for only 3 h at roomtemperature to preserve GFP ormRFP fluorescence. Primary antibodieswere as follows: α-EphA4 (Upstate; 1:200); α-EfnB2a (R&D Biosystems 1:100); α-aPKCζ (Santa Cruz C20 1:500); α-laminin Ab-1 (NeoMarkers/ThermoScientific RB-082-A1; 1:100);α-3A10 (DHSBank; 1:200) α-HU (Invitrogen; 1:200). Secondary antibodies were fluorochrome- conjugated Alexa Fluor 488 594 or 633 (Invitrogen). Gastrula stage mosaic analysis and confocal imaging Mosaics made by cell transplantation at early gastrula stages were performed as previously described (Carmany-Rampey and Moens 2006). Confocal imaging was essentially as previously described (Cooke et al. 2005). For time-lapse imaging embryos were mounted live at ∼10 hpf in a drop of 0.6% low-melting-point agarose on a 35mmcoverglass-bottom culture dish (MatTek) and imaged for ∼10 h at 30 °C on a heated stage attached to a Zeiss Pascal confocal inverted microscope. The phenotypes ascribed to each of the types of mosaics described in Fig. 1 and Table 1 were apparent in more than 75% of the mosaics generated in any given experiment. High-resolution confocal timelapse imaging of clump formation in WT to EphA4 MO mosaics was performed on 9 embryos over the course of 6 separate experimental trials; quantitation of cell position and spindle orientation during clump formation was performed on a representative embryo as described in Fig S7 and Table 2. Confocal timelapse imaging of EfnB2a MO cells sorting out of WT r4 was performed on 6 embryos in 2 separate trials. The movies shown in Figs. S2–4 consist of projected z-stacks at 15 min intervals extracted from time-lapses obtained using a 20× objective with a 1.3–1.5× zoom. Images in Fig. 2 are projections corresponding to a 30-μm-deep volume in the middle of the dorso-ventral axis of the zebrafish hindbrain. Images in Fig. 4 are individual confocal sections extracted from a time-lapse obtained using a 40× water immersion objective and Immersol (Zeiss). Neural rod stage transplants Single cells or small groups of cells were transplanted from donor r3 to host r4 at the 10–12 somite stage (14–15 hpf) with a glass pipette with a 10–15 μm inner diameter using an oil-controlled micromanipulator mounted on a Zeiss Axioskop FSII fixed-stage microscope. Both donor and host embryos were from the pGFP5.3 transgenic line (Picker et al. 2002) which expresses GFP in r3 and r5. Donor embryos were injected at the 1-cell stage with biotin-conjugated dextran to visualize donor-derived cells after transplantation. Host embryos were imaged immediately after transplantation to confirm the location of donor-derived cells and then were fixed 4–5 h after transplantation. Krox20 expression was detected by RNA in situ hybridization followed by fluorescent detection of the biotin-dextran using the TSA kit (Molecular Probes now Invitrogen). Donor cells in r4 were scored as “plastic” if they lacked krox20 expression and “not plastic” if they still expressed krox20. Quantitation of cell position and spindle orientation during cell divisions in the neuroepithelium Cell divisions were observed over the course of the time-lapse described in Fig. 4. r3 and r5 were identified by GFP expression in the pGFP5.3 transgenic host embryo (Picker et al. 2002). It has previously been described that formation of the neural keel occurs between 6 and 10 s (12–14 hpf) transition into the neural rod is complete by 14 s (16 hpf) and the neural tube stage begins at 17–18 s (17 hpf) (Geldmacher-Voss et al. 2003). In our experiments cross-midline division of donor cells in r4 were observed as early as 12.5 hpf and planar divisions typical of neural tube stage were first observed at 17 hpf. The midlinewas defined as equidistant from each of the lateral surfaces of the neuroepithelium. Nuclear position of dividing cellswas scored as medial if closer to the midline and lateral if closer to the lateral edges of the neuroepithelium. Spindle orientation was assumed to be perpendicular to the plane of the metaphase plate. Divisions were scored as planar if the angle between the midline and the spindle at anaphase was less than 45° and scored as apico-basal if the angle between the spindle and midline was more than 45° consistent with previous criteria used to determine spindle orientation in chicken and zebrafish neuroepithelia (Geldmacher-Voss et al. 2003; Roszko et al. 2006). Final position of daughter cells was scored as bilateral if one daughter crossed the midline after mitosis and unilateral if both daughters remained on the same side. Cell division inhibitors To block cross-midline cell divisions embryos were cultured from 90% epiboly onwards in embryo medium containing 100 μM aphidicolin (Sigma) and 20 mM hydroxyurea (Sigma) dissolved in 4% DMSO as previously described (Tawk et al. 2007). Control embryos were treated with 4% DMSO.

Microscopic Technique
Confocal Microscopy

Cell Type(s)
EfnB2a MO