Technical Reference #1630

1630.

MCP-1 Involvement in Glial Differentiation of Neuroprogenitor Cells Through APP Signaling Emmaneul Vrotsos; Pappachan Kolattukudy; Kiminobu Sugaya, University of Central Florida, Brain Research Bulletin, 79(1630), (2009)

Abstract:
Previously it has been reported that neural stem cells undergoing apoptotic stress have increased levels ofamyloid precursor protein (APP) and increased APP expression results in glial differentiation. APP activitywas also shown to be required for sta

Keywords:
Amyloid precursor protein; monocyte chemoattractant protien 1; glial differentiation; neuroprogenitor

Materials & Methods:
2.1. Cell culture The NTera-2/Clone D1 cells (NT2) were plated at a density of 5×106 per 75cm2 in tissue culture treated flask (Corning). Cell culturemediawas Dulbecco’s modified Eagle’s medium with F-12 (DMEM/F12 Invitrogen) supplemented with 10% heat inactivated fetal bovine serum (Atlanta Biologics). An incubation chamber was used to maintain a humidified atmosphere of 5% CO2 and 37 ◦C. NT2 cells were passed twice a week by 0.05% Trypsin/EDTA (Invitrogen) treatment. 2.2. Transfection Transfection of plasmid DNA was performed with Lipofectamine 2000 (Invitrogen). Transfections were performed on subconfluent NT2 cells in 6 well plates (Corning) or 35mm glass bottom dishes (MatTek). Transfection efficiency was determined by observation of GFP expression under fluorescence microscope or immunoblot analysis with GFP antibody. AICD plasmid transfection efficiency was determined by co-transfection with GFP plasmid. Plasmids: pEGFP-C1 (Clonetech) pCDNA4/His-Max TOPO (Invitrogen) pCEP-APP-GFP MCPIP-GFP (provided by Dr. Pappachan E. Kolattukudy University of Central Florida) AICD pCDNA3 APP-C59 (provided by Dr. Fuyuki Kametani Tokyo Institute of Psychiatry). 2.3. Small interference RNA Small interference (siRNA) for human APP695 (Accession: A33292) was designed using Ambion software. Target sequence for APP695 (5 ATCTTTGGAACAGGAAGCAG3 ). Preparation of siRNA was done using Silencer Expression (Ambion). SiRNA cassette was then subcloned into pCDNA4/His-Max TOPO plasmid (Invitrogen). 2.4. Reagents and antibodies Primary antibodies: rabbit anti-GFAP (Promega); mouse anti-APP (22C11) (Chemicon); mouse anti-GFP (Invitrogen); rabbit anti-Beta Actin (Cell Signaling); mouse anti-Cleaved PARP (Cell Signaling); mouse anti-ERK; mouse anti-ERK1/2 (pT202/pY204) (BD Biosciences); rabbit ant-STAT3 (BD Biosciences); rabbit anti- STAT3 (pY705) (Cell Signaling); mouse anti-p38 MAPK; mouse anti-p38 MAPK (pT180/pY182) (BD Biosciences). Secondary antibodies: anti-mouse IgG and antirabbit IgG horseradish peroxidase-conjugated antibodies (Amersham); TRITC conjugated antibody (Jackson Immuno). Reagents and kinase inhibitors: Secreted type amyloid precursor protein alpha S9564-25UG (Sigma). Trypan blue (Sigma); JAK1 inhibitor (calbiochem); p38 MAPK inhibitor-SB203580 (Sigma); and ERK1/2 inhibitor-PD098059 (Sigma). Cellswere pretreated with kinase inhibitors for 45min prior to plasmid transfection. 2.5. Immunoprecipitation and immunoblot analysis Protein samples were collected from cells lysed by ice cold lysis buffer consisting of 1% NP40 150mM NaCl 50mM Tris pH 8.0 and protease inhibitor cocktail (Calbiochem). The protein concentrationwasmeasured using Bradord reagent (Bio- Rad). For immunopreciptation experiment cell lysates were immunoprecipitated with an antibody against ERK STAT3 p38 MAPK using protein G-Sepharose (Amersham Bioscience). Then precipitates or cell lysateswere heated at 90 ◦C for 10min in a sample loading buffer and separated onNuPAGE 4–12% Bis-Tris Gel (Invitrogen) for 60 min at 200V and subsequently transferred to a PVDF membrane (30V for 90 min). Membranes were incubated in blocking solution (5% milk in PBS with 0.05% Tween 20 (PBS-T) (Invitrogen) for 2 h at room temperature (RT). Membranes were probed with primary antibody in blocking solution overnight at 4 ◦C. The membranes were washed three times for 5 min with PBS-T and then incubated with horseradish peroxidase conjugated secondary antibodies in blocking solution for 2 h at RT. After three washes with PBS-T protein bands were visualized with ECL plus chemilluminescence reagent (Amersham Bioscience). Immunoblot images were captured by KODAK Image Station 2000MM. Protein values were normalized to Beta Actin expression. Image analysis and data normalization was done using ImageJ 4.10 software (NIH). 2.6. Immunocyotohemistry Cells were fixed in 4% paraformaldehyde 30 min at RT washed three times for 5min in PBS then incubated in PBS-T for 1 h at RT. Cells were then blocked with 3% Normal Donkey Serum in PBS-T (blocking solution). Next samples were incubated with primary antibody diluted in blocking solution for 2 h at RT. Cells were washed three times for 5 min in PBS prior to adding secondary antibody diluted in blocking solution. Secondary antibody incubationwas done overnight at 4 ◦C. Cellswere then washed thoroughly and air-dried prior to adding Vectashield mounting media with DAPI (Vector). 2.7. Microscopy Imaging was done using an inverted fluorescent microscope (Leica DMI 6000B) with differential interphase contrast (DIC). DAPI/Rhodamine/FITC filter cube (Chroma) was utilized for fluorescent microscopy. Image analysis was done using Openlab Software 4.0.1 (Improvision). 2.8. Quantitative RT-PCR Total RNA was extracted from the cells with Trizol reagent (Invitrogen). cDNA synthesis and RT-PCR reactions were performed using iQ SYBER Green Supermix (Biorad). RT-PCR conditions were pre denaturation for 2 min at 94 ◦C; 35 cycles of 94 ◦C for 15 s: 55–60 ◦C for 30 s; and 72 ◦C for 30 s; and a post extension at 72 ◦C for 2 min. RT-PCR reaction was performed using iCycler (Biorad). Fold change was determined using the pfaffl method [23]. 2.9. RT-PCR primers GFAP (+) 5-AAGCAGTCTACCCACCTCAG-3 (−) 5-ATCCCTCCCAGCACCTCATC- 3; APP (+) 5-CTTGAGTAAACTTTGGGACATGGCGCTGC-3 (−) 5-GAACCCTACGAAGAAGCC- 3; Beta Actin (+) 5-GACAGGATGCAGAAGGAGAT-3 (−) 5-TTGCTGATCCACATCTGCTG- 3; MCP-1 (+) 5-GCGAGCTATAGAAGAATCACC-3 (−) 5-ATAAAACAGGGTGTCTGGGG- 3; MCPIP (+) 5-AACTGGAGAAGAAGAAGATCCTGG-3 (−) 5- ATTGACGAAGGAGTACATGAGCAG-3. 2.10. Statistical analysis Experiments were done in triplicate and standard deviation was determined. A t-test analysis was performed to determine statistical significance of experimental group compared to control group.

Microscopic Technique
Fluorescence Microscopy

Cell Type(s)
NT2