Technical Reference #1617

1617.

Oral-Aboral Axis Specification in the Sea Urchin Embryo III. Role of Mitochondrial Redox Signaling via H2O2 James Coffman; Alison Coluccio; Antonio Planchart; Anthony Robertson, Mount Desert Island Biological Laboratory, Developmental Biology, 330(1617), (2009)

Abstract:
In sea urchin embryos specification of the secondary (oral–aboral) axis occurs via nodal expression of whichis entirely zygotic and localized to prospective oral ectoderm at blastula stage. The initial source of this spatialanisotropy is not known.

Keywords:
axis specification; nodal; redox; ROS; hydrogen peroxide; mitochondria

Materials & Methods:
Animals and embryo culture S. purpuratus were obtained from Santa Barbara Marine Biologicals (Charles Hollahan Santa Barbara CA) or from the Point Loma Marine Invertebrate Lab (Pat Leahy Coronal del Mar CA). Gametes were released by vigorous shaking of adult sea urchins. Egg fertilization and embryo culture were carried out in artificial seawater (ASW) using standard methods (Foltz et al. 2004). Microinjection staining and imaging of embryos Microinjections of zygotes affixed to protamine sulfate-coated dishes were performed using standard methods of timed pressure injection (Cheers and Ettensohn 2004). For RNA injections 50–100 ng/ μl were used for GFP-OMP25 and 400–1000 ng/μl were used for SOD2 and Mt-Cat. For DNA injections a nodal-5P-GFP PCR amplicon (Nam et al. 2007; Fig. 1A) was injected at 0.5 ng/μl in a solution containing 20 ng/μl restriction-digested sea urchin DNA as carrier. This amount of nodal-5P-GFP was determined empirically to be the minimum required to give GFP fluorescence. All injection solutions contained 120mMKCl. Blastomere injections included 2 mg/ml 10000 MW Dextran Alexa- Fluor 647 (Invitrogen Molecular Probes). Confocal imaging was performed using a Zeiss LSM 510 microscope. For live imaging embryos were affixed to protamine sulfatecoated glass-bottom MatTek dishes (MatTek Corp. Ashland MA USA) injected with RNA or DNA as described above and imaged on a cooled stage maintained at 12 °C. In some cases eggs or embryoswere stained with 200 nM MitoTracker™ Deep Red or MitoTracker™ Orange (Invitrogen Molecular Probes) for 20 min in the dark. For detection of ROS embryos were stained in 10 μM CM-H2DCFDA (Invitrogen Molecular Probes) for 20–60 min in the dark and exposed to a minimum amount of fluorescence excitation before being imaged in order to minimize photo-oxidation of the dye. For antibody staining MitoTracker™ Deep Red-labeled embryos were fixed with 4% para-formaldehyde in ASW with 10 mM EPPS (pH 8.0) supplemented with Roche PhosStop reagent (PS) for 10 min at room temperature (RT) with gentle agitation in the dark. Embryos were then washed twice in ASW+PS three times in ice cold methanol (MeOH) and stored in MeOH at −20 °C. Fixed embryos were washed four times in PBS+0.1% Tween-20+PS (PBST-PS) blocked for 30 min at 4 °C in 4% normal goat serum (NGS) in PBST-PS and stained with rabbit anti-phospho-Smad3 (Rockland #600-401-919) at 1:100 dilution in PBST-PS overnight at 4 °C. The embryos were washed four times in PBST-PS incubated in Alexa-Fluor 488 goat anti-rabbit IgG (Invitrogen #A11008 20 μg/ml in PBST-PS) for 3 h in the dark at RT and washed again (4×) in PBST-PS. The stained embryos were then transferred to 50% glycerol/PBST-PS and mounted for imaging with DAPI (1 μg/ml). For quantitation images were analyzed using ImageJ (NIH v. 1.38). Using the tools provided in ImageJ boundaries were drawn around the embryo images and the average pixel intensity within the boundaries calculated. To obtain the average MitoTracker pixel intensity for half an embryo the boundary on one half of the embryo was manually moved to form a line down the center of the embryo (thereby bisecting the image verified by calculation of the resulting area) and the average pixel intensity within the half-embryo thus bounded was calculated and compared to the average pixel intensity for the whole. Late gastrula stage embryos containing fluorescent lineage tracer were scored by placing the embryos at the time of hatching in an agarose tunnel (Ransick and Davidson 1995). The embryos were viewed with epifluorescence on a Zeiss Axiovert 200 inverted microscope scored and digitally imaged using a Zeiss MRc Axiocam. In general the lineage tracer exhibited the typical ‘oral-lateral’ and ‘aboral-lateral’ patterns described by Cameron et al. (1989). Embryos exhibiting the oral-lateral pattern of lineage tracer were scored as ‘oral’; embryos exhibiting the aboral-lateral pattern were scored as ‘aboral’. Ambiguous cases that could not be assigned to either the oral or aboral categories were scored as ‘lateral’ or ‘defective’ depending on the phenotype of the embryo. Constructs A nodal-GFP BAC knock-in construct was used as PCR template to amplify linear nodal-5P-GFP DNA as described previously (Nam et al. 2007). The GFP-OMP25 construct consisted of the C-terminal 38 amino acid codons derived from Mus musculus Omp25 (Synj2bp; Genbank accession NM_025292) cloned in-frame into the C-terminal poly-linker site of pEGFP-C1. This region consists of a mitochondrial targeting signal that targets and anchors OMP25 to the mitochondrial outer membrane (Nemoto and De Camilli 1999). This plasmid was used as a PCR template to amplify a T7 promoter-containing transcription template using the following primers: TAATACGACTCACTATAGGGTTTAGTGAACCGTCAGATCCGCTA (forward) and CCCTTTGACGTTGGAGTCCACGTTCT (reverse). The eGFP-coding mRNA synthesized fromthis template covers a region from43 bases upstream of the eGFP start to downstream of the SV40 polyA signal a total of 1384 nucleotides. Mt-Catalase was constructed by cloning the OMP25 C-terminal sequence fromthe above construct into the pGloBlu plasmid a derivative of pBluescript (Stratagene) containing the Xenopus β-globin 3′ UTR and polyadenylation site (Coffman et al. 2004). The OMP25 Cterminal targeting sequence was inserted between the HindIII and XbaI sites of pGloBlu as a HindIII–XbaI digest of the 114 bp PCR amplicon generated from the parent vector with the following primer set: GCCAAGCTTGCTTGCTCATCGAGGTGAAGGAGAGCCAAGTGGAGT (forward) and TCTCTAGATCAAAGCTGCTTTCGGTATCTCACGAA (reverse). Adjustmentswere included in these primers so that the coding sequence of sea urchin catalase (Genbank Acc. No. CX561177) could be added inframe relative to the signal sequence as a XhoI and HindIII digest of the 1610 bp PCR amplicon generated from the library clone with the following primers: ACCTCGAGGACGTGGTACTGCTGTTCTCTTTCCCAT (forward) and AGTCGTCCGATTGGACCTTACAGGTT (reverse). The final construct contains 28 bp of 5′ UTR and the catalase coding sequence with the C-terminal 14 codons replaced with 37 codons of OMP25 targeting sequence and ending with an introduced stop codon. This construct was linearized with SacI and used as template to synthesize mRNA using the Ambion T7 mMessage Machine kit. For SOD2 expression the full-length coding sequence of SOD2 was initially amplified from total RNA extracted from adult testis tissue with Invitrogen one-step PCR kit and the following primers: AGGTACCGCACTTCAAATAACATAATGGCGTCTGCT (forward) and TCTCGAGGAACCTCATAATCCCCAGACCACCA (reverse). The resulting amplicon was inserted into pGloBlu-OMP25 as a KpnI–XhoI fragment maintaining a continuous open reading frame relative to the OMP25 targeting sequence. A second SOD2 expression construct lacking the OMP25 targeting sequence (i.e. wild-type SOD2 which localizes to the mitochondrial matrix) was subsequently inserted in pGloBlu following amplification of the full-length SOD2 coding sequence with the following primers: ACCTCGAGGCAGTGCAGTTACTGTGTATGTCTTTGCA (forward) and CTTCTAGAGCGCATTTCACTTGTCCTCATCTACAA (reverse). Both constructs were linearized with Pst1 and used as template to synthesize mRNA using the T7 mMessage Machine kit from Ambion. Since initial control experiments indicated that the two constructs were similarly effective in augmenting both ROS levels and p38 activitymost of the results reported below were obtained using the unmodified variant. Immunoblot Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) was performed on whole cell extracts from approximately 600 embryos per lane was using the NuPage Bis–Tris PAGE system(Invitrogen). Following transfer to nitrocellulose immunoblot analysis was performed using the WesternBreeze immunodetection kit (Invitrogen) with rabbit anti-phospho-p38 primary antibody (Cell Signaling Technology) diluted 1:1000. The signal obtained with an anti-trimethyl-K4-histone H3 antibody (H3K4me3; Upstate) diluted 1:20000 was used for a loading control. The immunoblots were imaged and the signals quantified using a Kodak GelLogic100 Imaging system. For quantification the background-subtracted band intensities of phospho-p38 were normalized to those of H3K4me3. Reverse transcriptase coupled polymerase chain reaction (RT-PCR) RT-PCR was carried out on a Cepheid SmartCyclerII as follows: starting with total RNA isolated from approximately 600 treated embryos (Qiagen RNeasy) cDNA was prepared from typically 250 ng of total RNA using random priming in the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). PCR reactions were performed starting with 2 μl of cDNA in a 25 μl reaction set up as prescribed for PerfeCta SYBR Green FastMix (Quanta Biosciences). Cycling conditions were as follows: an initial activation step at 95 °C for 150 s followed by cycles of 95 °C for 15 s 58 °C for 25 s and 72 °C for 45 s until 9 cycles after Ct. The Ctwas reached when the primary curve crossed a manual threshold setting of 30 fluorescence units. Melt curves were inspected following the cycling protocol and all products were analyzed on agarose gels to confirm product specificity. Nodal transcript abundance relative to a given control samplewas calculated by the formula 1.9ΔCt where ΔCt is the difference in Cts obtained for nodal in the treatment and control after normalization to the ΔCts obtained for either ubiquitin or HPRT which are assumed to be constant between treatments and/or time points. The sequences of primers used to amplify nodal and ubiquitin cDNA have been described (Coffman et al. 2004); the primers used to amplify HPRT cDNA are as follows: ACACATTCTGCGTCCCGAGGCAT (forward) and GGTCGGAGCAGAACTTGTAGCCTCCTT (reverse).

Microscopic Technique
Confocal Microscopy

Cell Type(s)
Mammalian